RESUMO
A colorimetric assay for highly selective and sensitive detection of tricyclazole using fluorescein-functionalized silver nanoparticles (F-AgNPs) as sensing probes was investigated. As the addition of tricyclazole to F-AgNPs, a drastic decrease in the absorbance at 394 nm was detected, which was accompanied with a noticeable color change from yellow to gray. The sensing mechanism involved an interaction between tricyclazole and F-AgNPs, which led to aggregation of the latter, inducing a color change from yellow to gray. An excellent linear calibration curve (R2 = 0.9994) was achieved between absorbance at 394 nm and the tricyclazole concentration in the range between 0.06 and 1.0 ppm. Moreover, the detection limit was estimated at 0.051 ppm. The developed colorimetric assay also showed good selectivity and was successfully utilized to quantify tricyclazole in rice samples with satisfactory recoveries. The proposed assay has been successfully applied for monitoring tricyclazole in rice samples.
Assuntos
Colorimetria/métodos , Nanopartículas Metálicas/química , Prata/química , Tiazóis/análise , Fluoresceína/química , Limite de Detecção , Oryza/química , Oryza/metabolismoRESUMO
BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (râ=â0.65869, Pâ=â0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.
Assuntos
Meningite Criptocócica/líquido cefalorraquidiano , Meningite Criptocócica/genética , Biologia Computacional , Cryptococcus/patogenicidade , Testes Diagnósticos de Rotina , Feminino , Genótipo , Humanos , Masculino , Meningite Criptocócica/diagnóstico , Análise MultivariadaRESUMO
Association of HLA class II with multiple sclerosis (MS) has been widely studied in both Western and Oriental populations. However, such an association is not well documented in Chinese. The objective of this study was to examine the association between the susceptibility to conventional MS in Southern Chinese with HLA-DRB1,-DPB1 alleles and putative DRB1-DPB1 haplotypes. Genotyping of HLA-DRB1 and -DPB1 alleles was performed in 60 patients with conventional MS and 95 controls. Allele frequencies were compared between patients and controls to identify MS-associated alleles. Relative predisposing effect method was used to compare haplotype frequencies in patients and controls and to identify possible predisposing DRB1-DPB1 haplotypes, which were further examined for differences in haplotype carriage rates between the two groups. We found that the allele frequency of DRB1*1501 was not different between patients (18.3%) and controls (21.1%) (p = 0.837). In contrast, frequency of the DPB1*0501 allele was significantly higher in patients (90%) than in controls (67.4%) (odds ratio = 4.36, p = 0.0013, pcorr = 0.025). DRB1-DPB1 linkage haplotype in patients (8.33%) was significantly higher than in controls (0%) (p < 0.0001) and the carriage rate of this haplotype was significantly increased in patients (15%) as compared with controls (0%) (p = 0.00013, pcorr = 0.003). Combined, these results suggest that HLA-DRB1*1501 is not associated with susceptibility to conventional MS in Southern Chinese. Instead, both the DPB1*0501 allele and the DRB1*1602- DPB1*0501 haplotype are strong predisposing factors for conventional MS in this population. Our results establish that the HLA profiles of MS in Southern Chinese are distinct from other populations.
Assuntos
Povo Asiático/genética , Antígenos HLA-DP/genética , Antígenos HLA-DR/genética , Esclerose Múltipla/genética , Adolescente , Adulto , Idoso , Estudos de Casos e Controles , China/epidemiologia , Feminino , Frequência do Gene , Estudos de Associação Genética , Predisposição Genética para Doença , Antígenos HLA-DP/imunologia , Cadeias beta de HLA-DP , Antígenos HLA-DR/imunologia , Cadeias HLA-DRB1 , Haplótipos , Humanos , Desequilíbrio de Ligação , Masculino , Pessoa de Meia-Idade , Esclerose Múltipla/etnologia , Esclerose Múltipla/imunologia , Razão de Chances , Fenótipo , Medição de Risco , Fatores de Risco , Adulto JovemRESUMO
OBJECTIVE: To characterize the deficiency of the mRNA expression of specific protein (SP3) gene in peripheral blood mononuclear cells (PBMCs) from Chinese patients with multiple sclerosis (MS) and study its correlation with the disease phenotypes. METHODS: Fifty-six patients with definite MS were collected and total RNA was extracted from their PBMCs. Specific primers corresponding to SP3 gene were designed and the mRNA expression of SP3 gene was detected by reverse transcriptase-PCR (RT-PCR) method. The deficiency of SP3 expression was compared among MS patients, irrelevant disease group and normal controls. RESULTS: Of the 56 MS cases, 23 (41.1%) were SP3-deficient. In contrast, the frequency of SP3-deficiency in normal subjects and irrelevant disease controls was 8.6% (5/35) and 14.3% (4/27), respectively. The frequency of the SP3-expression deficiency in MS patients was significantly higher than that in both control groups (P< 0.01). Within the MS cases, the scores of expanded disability status scale (EDSS) in the SP3-expressing subjects were significantly different from that in the SP3-deficient ones in the stable, but not in the active, phase of MS (P< 0.05). CONCLUSION: Author's observation suggested that deficient expression of SP3 gene occurs in Chinese MS patients, and that the SP3 expression may correlate with the clinical manifestations of MS and play roles in its immunological pathogenesis.